Oligo Pool Handling & dsDNA Preparation · WeaveSeq

Oligo Pool Handling & dsDNA Preparation

Objective

Receive, resuspend, QC, and prepare the IDT oPool for yeast transformation. Convert single-stranded oligos to double-stranded DNA with homology arms for gap repair.

1. Receiving the oPool

IDT ships oPools as a dried pellet in a 1.5 mL tube. The tube label includes the pool name, synthesis scale (pmol/oligo), and number of oligos.

Upon Arrival

Briefly centrifuge the tube (10 sec) to collect the pellet at the bottom.
Inspect the pellet — it should be a small white/translucent spot.
Store at −20°C until resuspension.

2. Resuspension

Buffer Choice

Buffer	Recommendation
IDTE (10 mM Tris, 0.1 mM EDTA, pH 8.0)	Use this. Manufacturer-recommended. Maintains pH, chelates nucleases.
Nuclease-free water (pH 7.0)	Acceptable for short-term use only.
DEPC-treated water	Do not use. Degrades DNA.

Calculation

For a pool with N oligos at P pmol/oligo:

Total pmol = N × P
Resuspension volume (µL) = Total pmol / desired concentration (pmol/µL)

Example: 384 oligos at 50 pmol/oligo → 19,200 pmol total → resuspend in 192 µL IDTE for 100 nM per oligo (100 pmol/µL total pool concentration).

Procedure

Add the calculated volume of IDTE buffer.
Pipette up and down 10× to mix.
If visible pellet remains: heat at 55°C for 5 min, vortex 30 sec, spin down.
Let equilibrate at room temperature for 30 min.
Measure A₂₆₀ on NanoDrop to confirm concentration.

Quality Control

Check	Expected
A₂₆₀ concentration	Within ±20% of calculated
A₂₆₀/A₂₈₀ ratio	1.8–2.0
Visual appearance	Clear, no precipitate

Storage

Aliquot into single-use volumes (e.g., 10 µL each)
Store at −20°C
Avoid >3 freeze-thaw cycles
Do not store at <1 µM per oligo long-term (DNA adsorbs to tube walls)

3. Oligo Structure

Each oligo in the IDT oPool has the following architecture (5′ → 3′):

┌──────────────┬────────────────────┬──────────────────────────────┐
│  5' homology  │  Binder CDS        │  3' homology arm (50 bp)     │
│   arm (50 bp) │  (AA_len × 3 bp)   │  c-Myc(30) + STOP(6) + ds(14)│
└──────────────┴────────────────────┴──────────────────────────────┘

Full Oligo Sequence (for one binder)

Using a 65 AA binder as an example:

5'-CTAGTGGTGGAGGAGGCTCTGGTGGAGGCGGTAGCGGAGGCGGAGGGTCG  ← 5' arm (50 bp, pCTCON2 bp 814–863)
   ATG...binder CDS...XXX                                  ← Codon-optimised CDS (AA_len × 3 bp, NO stop codon)
   GAACAAAAGCTTATTTCTGAAGAGGACTTG                          ← c-Myc tag (30 bp, in-frame with CDS)
   TAATAG                                                  ← Tandem stop codons (6 bp)
   CTCGAGATCTGATA                                          ← Downstream vector (14 bp)
                                                            -3'

Critical design point: The CDS runs directly into the c-Myc tag with no intervening stop codon. This produces the in-frame fusion protein:

Aga2p - HA - [spacer] - [BINDER] - c-Myc

The stop codon (TAATAG) comes after c-Myc. This is how the yeast surface display system detects full-length expression — the anti-c-Myc antibody only binds if translation continued through the entire CDS into the c-Myc tag. Premature stop codons in the CDS produce truncated protein that lacks c-Myc and is excluded from the sort gate.

3′ Arm Breakdown

Position in arm:  1        10        20        30        40        50
                  |        |         |         |         |         |
Sequence:         GAACAAAAGCTTATTTCTGAAGAGGACTTGTAATAGCTCGAGATCTGATA
                  └──────────┬──────────┘└──┬──┘└─────┬──────┘
                       c-Myc tag (30 bp)   STOP    downstream (14 bp)
                  EQKLISEEDL               TAA TAG

Total oligo length: 50 + (AA_len × 3) + 50 = 100 + (AA_len × 3) bp.

Binder AA	Total Length	IDT Limit
60 AA	280 bp	350 bp	✓
70 AA	310 bp	350 bp	✓
80 AA	340 bp	350 bp	✓
83 AA	349 bp	350 bp	✓
85 AA	355 bp	350 bp	✗ Exceeds

How Sequences Are Built (AffiniBind Pipeline)

candidate_table.annotated.parquet
        │
        ▼  sequence column: "MKYLLPTAAAGLLLLAAQPAMA..."
        │
        ▼  codon_optimizer.back_translate(exclude_stop=True)
        │  → "ATGAAATATTTGTTGCCAACTGCTGCTGCT..."
        │  (stop codons excluded — the stop is in the 3' arm)
        │
        ▼  oligo_builder.build_oligo()
        │  → 5' arm + CDS (no stop) + 3' arm (c-Myc + TAATAG + downstream)
        │
        ▼  idt_writer.write_idt_order()
        │  → IDT-format .xlsx with Pool name | Sequence

Configurable Parameters

All arm sequences are configurable via YAML. The defaults live in the Pydantic model affinibind/ordering/ysd/config.py (OligoConfigModel) and in the profile YAMLs' order_candidates section (e.g. affinibind/config/profiles/protein/full_campaign.yaml); they were verified against the full pCTCON2 sequence on 2026-08-11. affinibind/ordering/ysd/pctcon2.yaml defines only the IDT pool tiers. See SOP 01 for the verification procedure.

4. Conversion to Double-Stranded DNA

Oligos arrive as ssDNA. For yeast gap repair, they must be converted to dsDNA.

Method: One-Cycle RSPE (Reverse Strand Primer Extension)

This preserves library diversity — a single polymerase extension with no amplification, so every oligo is copied exactly once.

RSPE Reverse Primer (anneals to the 3′ end of every oligo in the pool):

5'-TATCAGATCTCGAGCTATTACAAGTCCTCTTCAGAAATAAGCTTTTGTTC-3'

This is the reverse complement of the 3′ homology arm. Because all oligos share the identical 3′ arm, a single primer extends the entire pool.

Property	Value
Length	50 nt
Tm (2-state)	~68°C
GC content	34%
Anneals to	3′ arm (bases 1–50 of the reverse strand)
Product	Full-length dsDNA matching each oligo

Reaction mix (50 µL):

Component	Volume	Final
Nuclease-free water	to 50 µL	—
5× Q5 Reaction Buffer	10 µL	1×
10 mM dNTPs	1 µL	200 µM each
10 µM RSPE reverse primer	2.5 µL	0.5 µM
Resuspended oPool (10–100 ng)	X µL	—
Q5 High-Fidelity DNA Polymerase (NEB M0491)	0.5 µL	1 U

Thermocycler program:

98°C — 30 sec (denaturation)
98°C — 10 sec
68°C — 30 sec (annealing; use Tm+3 for Q5, ~71°C if primer Tm >69°C)
72°C — 2 min (extension; 30 sec/kb for ~300 bp product)
4°C — hold

Purification: Zymo DNA Clean & Concentrator-5 (D4013). Elute in 20 µL nuclease-free water. Quantify by Qubit.

Alternative: Full PCR Amplification (If More DNA Is Needed)

If the RSPE yield is insufficient for electroporation, amplify the dsDNA pool with a limited number of PCR cycles.

Forward PCR Primer (anneals to 5′ arm):

5'-CTAGTGGTGGAGGAGGCTCTGGTGGAGGCGGTAGCGGAGGCGGAGGGTCG-3'

Reverse PCR Primer (same as RSPE primer, anneals to 3′ arm):

5'-TATCAGATCTCGAGCTATTACAAGTCCTCTTCAGAAATAAGCTTTTGTTC-3'

These primers match the constant regions shared by all oligos, so a single primer pair amplifies the entire pool.

PCR mix (50 µL):

Component	Volume
Q5 2× Master Mix	25 µL
10 µM Forward primer	2.5 µL
10 µM Reverse primer	2.5 µL
RSPE product (1–10 ng)	X µL
Nuclease-free water	to 50 µL

Thermocycler program:

Step	Temp	Time	Cycles
Denaturation	98°C	30 sec	1
Denaturation	98°C	10 sec
Annealing	68°C	15 sec	12–15
Extension	72°C	10 sec
Final extension	72°C	2 min	1

⚠️ Use ≤15 cycles. Excessive cycles cause PCR bias — abundant sequences amplify disproportionately, creating "jackpot" artifacts that dominate downstream sorting.

4. Quality Control Before Transformation

Check	Method	Passing Criterion
Concentration	Qubit dsDNA HS assay	≥50 ng/µL for electroporation
Size	1% agarose gel	Single band at expected size (±10%)
Purity	NanoDrop A₂₆₀/A₂₈₀	1.8–2.0
Yield	Total mass	≥12 µg insert DNA for 4 µg vector (3:1 ratio)

Expected Sizes

For a typical AffiniBind binder (60–80 AA):

CDS: 180–240 bp
- 5′ arm (40–100 bp): 220–340 bp
- 3′ arm (40–100 bp): 260–440 bp

Ensure the final dsDNA product size is within IDT's 40–350 nt limit for the original oligo. If your design exceeds 350 nt total, split across multiple oligos with overlap, or use a shorter linker.

5. References

IDT oPools FAQ: https://www.idtdna.com/pages/products/genes-and-gene-fragments/custom-oligo-pools/opools
IDT "My Oligos Arrived: Now What?" technical guide
NEB Q5 High-Fidelity DNA Polymerase protocol (M0491)