ProtocolsYSD Pipeline

Oligo Pool Handling & dsDNA Preparation

Standard operating procedure from the WeaveSeq experiments team, shared across the YSD pipeline runs.

Oligo Pool Handling & dsDNA Preparation

Objective

Receive, resuspend, and QC the IDT oPool, then convert the single-stranded oligos to dsDNA with homology arms for yeast gap repair.

1. Receiving the oPool

IDT ships oPools as a dried pellet in a 1.5 mL tube. The label lists the pool name, synthesis scale (pmol per oligo), and oligo count.

Upon Arrival

Centrifuge briefly (10 sec) to collect the pellet.
Inspect the pellet: a small white or translucent spot is expected.
Store at -20°C until resuspension.

2. Resuspension

Buffer Choice

Buffer	Recommendation
IDTE (10 mM Tris, 0.1 mM EDTA, pH 8.0)	Use this. Holds pH and chelates nucleases.
Nuclease-free water (pH 7.0)	Acceptable for short-term use only.
DEPC-treated water	Do not use. Degrades DNA.

Calculation

For a pool of N oligos at P pmol per oligo:

Total pmol = N × P
Resuspension volume (µL) = Total pmol / desired concentration (pmol/µL)

Example: 384 oligos at 50 pmol per oligo give 19,200 pmol total. Resuspend in 192 µL IDTE for a pool concentration of 100 pmol/µL.

Procedure

Add the calculated volume of IDTE buffer.
Pipette up and down 10 times to mix.
If a pellet is still visible: heat at 55°C for 5 min, vortex 30 sec, spin down.
Equilibrate at room temperature for 30 min.
Measure A₂₆₀ on a NanoDrop to confirm concentration.

Quality Control

Check	Expected
A₂₆₀ concentration	Within ±20% of calculated
A₂₆₀/A₂₈₀ ratio	1.8–2.0
Visual appearance	Clear, no precipitate

Storage

Aliquot into single-use volumes, for example 10 µL each.
Store at -20°C.
Avoid more than 3 freeze-thaw cycles.
Do not store below 1 µM per oligo long term: DNA adsorbs to tube walls.

3. Oligo Structure

Each oligo in the IDT oPool has this architecture (5′ to 3′):

┌───────────────┬────────────────────┬──────────────────────────────┐
│  5' homology  │  Binder CDS        │  3' homology arm (50 bp)     │
│  arm (50 bp)  │  (AA_len × 3 bp)   │  c-Myc(30) + STOP(6) + ds(14)│
└───────────────┴────────────────────┴──────────────────────────────┘

Full Oligo Sequence (for one binder)

Example, 65 AA binder:

5'-CTAGTGGTGGAGGAGGCTCTGGTGGAGGCGGTAGCGGAGGCGGAGGGTCG  ← 5' arm (50 bp, pCTCON2 bp 814–863)
   ATG...binder CDS...XXX                                  ← CDS (AA_len × 3 bp, no stop codon)
   GAACAAAAGCTTATTTCTGAAGAGGACTTG                          ← c-Myc tag (30 bp, in-frame)
   TAATAG                                                  ← stop codons (6 bp)
   CTCGAGATCTGATA                                          ← downstream vector (14 bp)
                                                            -3'

Critical design point: The CDS runs directly into the c-Myc tag with no intervening stop codon, producing the in-frame fusion protein:

Aga2p - HA - [spacer] - [BINDER] - c-Myc

The stop codon (TAATAG) sits after c-Myc. Full-length expression is detected only when translation runs through the whole CDS into the tag: a truncated protein carries no c-Myc and is excluded from the sort gate.

3′ Arm Breakdown

Position in arm:  1        10        20        30        40        50
                  |        |         |         |         |         |
Sequence:         GAACAAAAGCTTATTTCTGAAGAGGACTTGTAATAGCTCGAGATCTGATA
                  └──────────┬──────────┘└──┬──┘└─────┬──────┘
                       c-Myc tag (30 bp)   STOP    downstream (14 bp)
                  EQKLISEEDL               TAA TAG

Total oligo length: 50 + (AA_len × 3) + 50 = 100 + (AA_len × 3) bp.

Binder AA	Total length	IDT limit (350 bp)
60 AA	280 bp	OK
70 AA	310 bp	OK
80 AA	340 bp	OK
83 AA	349 bp	OK
85 AA	355 bp	Exceeds

How Sequences Are Built

The binder CDS is back-translated with stop codons excluded, then the 5' and 3' arms are appended. The pool is ordered from IDT as a pool-order file listing pool name and sequence.

Configurable Parameters

Arm sequences and lengths are configurable. Verify both arms against the full pCTCON2 vector sequence before ordering (SOP 01).

4. Conversion to Double-Stranded DNA

Oligos arrive as ssDNA. Gap repair needs dsDNA, so convert the pool before transformation.

Method: One-Cycle RSPE (Reverse Strand Primer Extension)

One extension per oligo with no amplification, so every oligo is copied exactly once and library diversity is preserved.

RSPE reverse primer (anneals to the 3′ end of every oligo):

5'-TATCAGATCTCGAGCTATTACAAGTCCTCTTCAGAAATAAGCTTTTGTTC-3'

It is the reverse complement of the 3′ homology arm, which all oligos share, so one primer extends the whole pool.

Property	Value
Length	50 nt
Tm (2-state)	~68°C
GC content	34%
Anneals to	3′ arm (bases 1–50 of the reverse strand)
Product	Full-length dsDNA matching each oligo

Reaction mix (50 µL):

Component	Volume	Final
Nuclease-free water	to 50 µL	n/a
5× Q5 Reaction Buffer	10 µL	1×
10 mM dNTPs	1 µL	200 µM each
10 µM RSPE reverse primer	2.5 µL	0.5 µM
Resuspended oPool (10–100 ng)	X µL	n/a
Q5 High-Fidelity DNA Polymerase (NEB M0491)	0.5 µL	1 U

Thermocycler program:

98°C for 30 sec (denaturation)
98°C for 10 sec
68°C for 30 sec (annealing)
72°C for 2 min (extension; 30 sec per kb for a roughly 300 bp product)
4°C hold

Purification: Zymo DNA Clean & Concentrator-5 (D4013). Elute in 20 µL nuclease-free water and quantify by Qubit.

Alternative: Full PCR Amplification (If More DNA Is Needed)

If RSPE yield is too low for electroporation, amplify the pool with a limited number of PCR cycles.

Forward PCR primer (anneals to the 5′ arm):

5'-CTAGTGGTGGAGGAGGCTCTGGTGGAGGCGGTAGCGGAGGCGGAGGGTCG-3'

Reverse PCR primer (same as the RSPE primer):

5'-TATCAGATCTCGAGCTATTACAAGTCCTCTTCAGAAATAAGCTTTTGTTC-3'

Both primers match constant regions shared by every oligo, so one pair amplifies the whole pool.

PCR mix (50 µL):

Component	Volume
Q5 2× Master Mix	25 µL
10 µM forward primer	2.5 µL
10 µM reverse primer	2.5 µL
RSPE product (1–10 ng)	X µL
Nuclease-free water	to 50 µL

Thermocycler program:

Step	Temp	Time	Cycles
Denaturation	98°C	30 sec	1
Denaturation	98°C	10 sec
Annealing	68°C	15 sec	12–15
Extension	72°C	10 sec
Final extension	72°C	2 min	1

Use ≤15 cycles. More cycles cause PCR bias: abundant sequences amplify disproportionately and create jackpot artifacts that dominate sorting.

5. Quality Control Before Transformation

Check	Method	Passing criterion
Concentration	Qubit dsDNA HS assay	≥50 ng/µL for electroporation
Size	1% agarose gel	Single band at the expected size (±10%)
Purity	NanoDrop A₂₆₀/A₂₈₀	1.8–2.0
Yield	Total mass	≥12 µg insert DNA for 4 µg vector (3:1 insert:vector mass ratio)

Expected Sizes

The product is 100 + (AA_len × 3) bp, so a 60–80 AA binder gives a 280–340 bp band. Original oligos must fall inside IDT's 40–350 nt synthesis range; split larger designs across two overlapping oligos or shorten the linker.

6. References

IDT oPools FAQ: https://www.idtdna.com/pages/products/genes-and-gene-fragments/custom-oligo-pools/opools
IDT "My Oligos Arrived: Now What?" technical guide
NEB Q5 High-Fidelity DNA Polymerase protocol (M0491)